Journal: Molecular Medicine Reports

Article Title: Roles and mechanisms of TRPC3 and the PLCγ/PKC/CPI-17 signaling pathway in regulating parturition

doi: 10.3892/mmr.2017.7998

Figure Lengend Snippet: Expression levels of TRPC3, Ca v 1.2, Ca v .3.1 and Ca v 3.2 in human myometrial smooth muscle cells derived from the non-pregnant, full-term without labor onset, preterm, and full-term with labor onset patient groups (n=20/group). (A) Western blot analysis of protein expression levels in the different groups. GAPDH was used as the loading control. Quantified western blot analyses of relative expression levels of (B) TRPC3, (C) Ca v 1.2, (D) Ca v .3.1 and (E) Ca v 3.2. Data are presented as the mean ± standard error. *P<0.05 vs. non-pregnant group. TRPC3, canonical transient receptor potential 3.

Article Snippet: Notably, extensive attempts to undertake western blot protocols using antibodies against L-type and T-type calcium channel subunits Ca v 1.2 (rabbit, 239 kDa, 1:1,000; Abcam; cat. no. ab58552), Ca v 3.1 (rabbit; 262 kDa; 1:1,000; Abcam; cat. no. ab203577), Ca v 3.2 (rabbit, 262 kDa; 1:1,000; Abcam; cat. no. ab128251) antibodies to detect proteins at the respective molecular weights.

Techniques: Expressing, Derivative Assay, Western Blot

Journal: Molecular Medicine Reports

Article Title: Roles and mechanisms of TRPC3 and the PLCγ/PKC/CPI-17 signaling pathway in regulating parturition

doi: 10.3892/mmr.2017.7998

Figure Lengend Snippet: Expression levels of TRPC3, MAPK, P-ERK, Ca v 1.2, Ca v .3.1 and Ca v 3.2 in mouse myometrial smooth muscle cells derived from the non-pregnant, preterm, infected preterm and full-term groups (n=10/group). (A) Western blot analysis of protein expression levels in the different groups. GAPDH was used as the loading control. Quantified protein expression levels of (B) TRPC3, (C) MAPK, (D) P-ERK, (E) Ca v 1.2, (F) Ca v .3.1 and (G) Ca v 3.2. Data are presented as the mean ± standard error. *P<0.05 vs. non-pregnant group. TRPC3, canonical transient receptor potential 3; MAPK, mitogen-activated protein kinase; ERK, extracellular signal-related kinase; P-, phosphorylated.

Article Snippet: Notably, extensive attempts to undertake western blot protocols using antibodies against L-type and T-type calcium channel subunits Ca v 1.2 (rabbit, 239 kDa, 1:1,000; Abcam; cat. no. ab58552), Ca v 3.1 (rabbit; 262 kDa; 1:1,000; Abcam; cat. no. ab203577), Ca v 3.2 (rabbit, 262 kDa; 1:1,000; Abcam; cat. no. ab128251) antibodies to detect proteins at the respective molecular weights.

Techniques: Expressing, Derivative Assay, Infection, Western Blot

Journal: Molecular Medicine Reports

Article Title: Roles and mechanisms of TRPC3 and the PLCγ/PKC/CPI-17 signaling pathway in regulating parturition

doi: 10.3892/mmr.2017.7998

Figure Lengend Snippet: (A) Western blot analysis of proteins in mouse myometrial smooth muscle cells with and without TRPC3-siRNA transfection. GAPDH was used as the loading control. Quantified protein expression levels of (B) TRPC3, (C) PLCγ, (D) PKC, (E) CPI-17, (F) P-CPI-17, (G) Ca v 1.2, (H) Ca v 3.1 and (I) Ca v 3.2. Data are presented as the mean ± standard error. *P<0.05 vs. CON group. CON, untransfected non-infected with LPS; LPS, infected with LPS; siTRPC3 CON, transfected with siTRPC3 and non-infected with LPS; siTRPC3 LPS, transfected with siTRPC3 and infected with LPS. TRPC3, canonical transient receptor potential 3; siRNA, small interfering RNA; PLC, phospholipase C; PKC, protein kinase C; CPI-17, C-kinase-activated protein phosphatase-1 inhibitor; LPS, lipopolysaccharides; CON, control.

Article Snippet: Notably, extensive attempts to undertake western blot protocols using antibodies against L-type and T-type calcium channel subunits Ca v 1.2 (rabbit, 239 kDa, 1:1,000; Abcam; cat. no. ab58552), Ca v 3.1 (rabbit; 262 kDa; 1:1,000; Abcam; cat. no. ab203577), Ca v 3.2 (rabbit, 262 kDa; 1:1,000; Abcam; cat. no. ab128251) antibodies to detect proteins at the respective molecular weights.

Techniques: Western Blot, Transfection, Expressing, Infection, Small Interfering RNA

Journal: Nucleic Acids Research

Article Title: Genome-wide CRISPR/Cas9 transcriptional activation screen identifies a histone acetyltransferase inhibitor complex as a regulator of HIV-1 integration

doi: 10.1093/nar/gkac464

Figure Lengend Snippet: Identification of HIV inhibitory factors by genome-wide SAM CRISPR/Cas9 screening. ( A ) Schematic representation of the genome-wide SAM CRISPR/Cas9 screen of human MT4 cells. A stable MT4 cell line expressing dCas9-VP64 and MS2-p65-HSF1 was transduced with the sgRNA library, infected with HIV-TK, and then treated with ganciclovir (GCV) to further deplete HIV-infected cells. The HIV-TK infection and GCV selection cycle was repeated, and surviving HIV-resistant cells were sorted for analysis. sgRNA libraries were prepared from genomic DNA by nested PCR and sequenced. Differentially enriched sgRNAs were identified and the genes were further analyzed as candidate HIV-1 restriction factors. ( B ) Target hit validation. MT4 cells were transduced with control shRNA (shNC) or the indicated gene-specific shRNAs for 2 days followed by infection with HIV-TK (MOI 0.1) for 3 days. Cells were harvested to extract the RNA, and RT-PCR was performed to quantify the expression of HIV-1 env relative to GAPDH. Mean ± SD of n = 3. * P < 0.05, ** P < 0.01, **** P < 0.0001, by Student's t test. ( C , D ) SAM mediated activation of SET, KCTD1, KiAA1586, ORAI3, and ATP1B1 inhibit HIV-1 replication. dCas9 and MS2 MT4 cells were transduced with lentivirus expressing control sgRNA (sgNC) or sgRNA of indicated genes. After 2 days, cells were infected with HIV-1 LAI at an MOI of 0.1 for 3 days. Cellular RNA was extracted, and RT-qPCR was performed to quantify the expression of HIV-1 env relative to GAPDH (C). The release of HIV-1 particles in the supernatant was detected by p24 ELISA (D). Mean ± SD of n = 3. ** P < 0.01, *** P < 0.001, **** P < 0.0001, by Student's t test.

Article Snippet: HiFi Cas9 Nuclease V3), SET-specific crRNA (GAGCAGCACCAUGUCGGCGCGUUUUAGAGCUAUGCU) or a non-targeting control crRNA , tracrRNA (Alt-R ® CRISPR-Cas9 tracrRNA), and electroporation enhancer (Alt-R ® Cas9 Electroporation Enhancer) were purchased from Integrated DNA Technologies.

Techniques: Genome Wide, CRISPR, Expressing, Transduction, Infection, Selection, Nested PCR, shRNA, Reverse Transcription Polymerase Chain Reaction, Activation Assay, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay

Journal: Nucleic Acids Research

Article Title: Genome-wide CRISPR/Cas9 transcriptional activation screen identifies a histone acetyltransferase inhibitor complex as a regulator of HIV-1 integration

doi: 10.1093/nar/gkac464

Figure Lengend Snippet: SET restricts HIV-1 replication in human CD4+ T cell lines and human PBMCs. (A–E) Knockout of SET enhances HIV-1 replication in CD4+ T cells. ( A ) Illustration of the three sgRNAs used for CRISPR/Cas9-mediated SET KO. ( B ) SET protein expression was analyzed in control sgRNA (sgNC) or SET sgRNA (sgSET #1, or #2 + 3) transduced MT4 cells by Western blotting. ( C ) Characterization of single Jurkat T cell clone knocked out for SET expression. Jurkat cells were transduced with sgSET#1 and SET expression was determined by Western blotting. ( D ) Control or SET depleted cells from panel B were infected with HIV-1 LAI at an MOI of 0.01 for 4 days. Time dependent p24 released in the supernatant was detected by p24 ELISA. ( E ) Control or SET knockout cells from panel C were infected with HIV pseudovirus (HIVpp-luc, MOI = 0.2) for 3 days. RNA was collected at the indicated times and HIV-1 env expression was quantified by RT-qPCR and normalized to GAPDH. (F–H) Ectopic expression of SET isoform 2 decreases HIV-1 replication. ( F ) Schematic representation of the 4 isoforms of SET. ( G ) SET isoform 2 was overexpressed in MT4 cells and SET expression was determined by Western blotting. ( H ) The cells were infected with HIVpp-luc at an MOI of 0.2. After 2 days, luciferase levels were measured. ( I–K ) KD of SET enhances HIV-1 replication in primary PBMCs from three different donors. Primary PBMCs were isolated from three healthy donors. T cells were activated using CD3 and CD28 antibodies. PBMCs were transduced with lentivirus vectors expressing non-targeting shRNA (shNC) or three SET specific shRNAs (shRNA1-3), followed by infection with HIV-1 LAI at an MOI of 0.02 or 0.1 for 3 days. p24 released in the supernatant was detected by p24 ELISA. ( L ) Control or SET depleted cells from panel C were infected with an X4-tropic stain Wilmington and a dual-tropic strain RF at an MOI of 0.01 for 3 days. RNA was collected and HIV env mRNA was quantified by RT-qPCR and normalized to GAPDH expression. ( M, N ) KD of SET enhances HIV-1 replication in microglia cells. Lentivirus expressing control shRNA or two SET specific shRNA were transduced into microglia cells (CHME) followed by puromycin selection for 7 days. Stable cell lines were infected with an R5-tropic stain Bal and a dual-tropic strain RF at an MOI of 0.2 for 3 days. env mRNA (M) and SET mRNA (N) was detected by RT-qPCR and normalized to GAPDH expression. Data in (B), (C) and (G) are representative of at least two independent experiments. GAPDH was used as a loading control. Mean ± SD of n = 3. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001 by Student's t test.

Article Snippet: HiFi Cas9 Nuclease V3), SET-specific crRNA (GAGCAGCACCAUGUCGGCGCGUUUUAGAGCUAUGCU) or a non-targeting control crRNA , tracrRNA (Alt-R ® CRISPR-Cas9 tracrRNA), and electroporation enhancer (Alt-R ® Cas9 Electroporation Enhancer) were purchased from Integrated DNA Technologies.

Techniques: Knock-Out, CRISPR, Expressing, Western Blot, Transduction, Infection, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR, Luciferase, Isolation, shRNA, Staining, Selection, Stable Transfection

Journal: Nucleic Acids Research

Article Title: Genome-wide CRISPR/Cas9 transcriptional activation screen identifies a histone acetyltransferase inhibitor complex as a regulator of HIV-1 integration

doi: 10.1093/nar/gkac464

Figure Lengend Snippet: SET represses HIV-1 integration but does not alter integration sites. (A–C) SET knockout in PBMCs enhances the integration of HIV-1. ( A ) Illustration of in vitro ribonucleoprotein complexes (Cas9-RNPs) formation and delivery into PBMCs. PBMCs isolated from the blood of healthy donors were activated by using CD3 and CD28 antibodies. Then, cells were electroporated with Cas9-RNPs, which consisted of the Cas9 nuclease bound to a SET CRISPR RNA (crRNA-SET) and the trans-activating crRNA (tracRNA). ( B , C ) PBMC of two healthy donors were delivered with the SET Cas9-RNPs. After 6 days in culture to allow for depletion of the targeted gene, the cells were infected with HIVpp-luc (MOI = 2) for 3 days to enable efficient integration of the single cycle reporter virus. Integrated HIV-1 DNA was quantified by Alu qPCR, and SET expression detected using Western blot. Integrated HIV-1 DNA was normalized to genomic GAPDH. Mean ± SD of n = 3. * P < 0.05, *** P < 0.001 by Student's t test. Western blot data are representative of at least two independent experiments. Tubulin was used as a loading control. ( D–G ) SET depletion does not appreciably alter sites of HIV-1 integration. HIV-1 integration site sequencing was performed in HIVpp-luc infected (MOI = 0.2) MT4 cells depleted for SET by the MLV KD system. Meanwhile, two SET depleted sets of PBMCs prepared in panels (B), (C) were subjected to integration site sequencing. Cellular DNA from infected control or SET depleted cells were extracted. Sites of HIV-1 integration, which were amplified by ligation-mediated PCR, were sequenced using Illumina. Integration site analysis of HIV-1 DNA integration sites mapped with respect to RefSeq genes (D), surrounding gene density (E), SPADs (F) and LADs (G). RIC, random integration control. ( H, I ) SET inhibits H3ac-associated HIV-1 DNA. Acetylated H3 ChIP (H3ac-ChIP, H) and total H3 ChIP (I) assays of Jurkat cells expressing sgNC (control) or sgSET (SET KO) and infected with HIV-1 LAI (MOI = 1) for 2 days. Immunoprecipitates were subjected to qPCR with primers specific for four regions of HIV-1 DNA: Nucleosome (Nuc)-0, Nuc-1, Nuc-2 and DHS (DNase I highly sensitive). Mean ± SD of n = 2. * P < 0.05, ** P < 0.01 by Student's t test.

Article Snippet: HiFi Cas9 Nuclease V3), SET-specific crRNA (GAGCAGCACCAUGUCGGCGCGUUUUAGAGCUAUGCU) or a non-targeting control crRNA , tracrRNA (Alt-R ® CRISPR-Cas9 tracrRNA), and electroporation enhancer (Alt-R ® Cas9 Electroporation Enhancer) were purchased from Integrated DNA Technologies.

Techniques: Knock-Out, In Vitro, Isolation, CRISPR, Infection, Expressing, Western Blot, Sequencing, Amplification, Ligation

Journal: Cell

Article Title: Polyamine metabolism is a central determinant of helper T cell lineage fidelity

doi: 10.1016/j.cell.2021.06.007

Figure Lengend Snippet: Synthesis of the amino acid hypusine underlies the central requirement for polyamine synthesis in T H lineage commitment (A) PA synthesis and its role in eIF5A hypusination. (B) Immunoblot of total EIF5A and hypusinated (EIF5A H ) in CD4 + T cells from WT mice activated for indicated time or rested overnight in 10 ng/mL IL-7 (naive). Representative of 3 biological replicates. (C) Immunoblots of WT and Odc −/− naive CD4 + T cells activated for 48 h. Representative of 3 biological replicates. N.B., same loading control and samples were used as in Figure 2 A. (D and E) Naive WT and Odc −/− CD4 + T cells electroporated with g Dhps or gCTRL and Cas9. Cells were then activated under T H 17 conditions ±250 μM putrescine. After 96 h, proteins were assessed by (D) immunoblot and (E) cytokines expression analyzed by FC. All data are mean ± SEM (p ∗ < 0.05, p ∗∗ < 0.005, p ∗∗∗ < 0.0005, p ∗∗∗∗ < 0.00005). (B–E) Representative of 2 experiments.

Article Snippet: Alt-R S.p. Cas9 Nuclease V3 , IDT , Cat. 1081059.

Techniques: Western Blot, Control, Expressing

Journal: Cell

Article Title: Polyamine metabolism is a central determinant of helper T cell lineage fidelity

doi: 10.1016/j.cell.2021.06.007

Figure Lengend Snippet: The polyamine-hypusine axis regulates the T cell epigenome to enforce appropriate T H cell differentiation and function (A) RNA-seq of naive WT, Odc −/− , and Dohh −/− CD4 + T cells polarized for 96 h. Effect of Odc and Dohh deficiency is shown via principal component analysis, indicating the percentage of variance allocated to each component in parenthesis. (B) Venn diagram depicting number of differentially regulated genes disparate, or shared, between Odc −/− and Dohh −/− CD4 + T cells of indicated T H lineage. Dashed circle indicates number of differentially expressed genes common to all T H cell subsets. (C) ATAC-seq on CD4 + T cells treated as in (A). (D) Venn diagram depicting number of differentially regulated regions of open chromatin disparate or shared between Odc −/− and Dohh −/− CD4 + T cells. Dashed circle indicates number of differentially regulated regions of open chromatin common to all T H cell subsets. (E) WT, Odc −/− , or Dohh −/− CD4 + T cells assayed for chromatin modifications by FC on day 4. Analysis performed on Ki-67 + , diploid cells with “single” DNA content based on FxCycle (DAPI) staining in live cell gate. (F) ATAC-seq on naive CD44 lo CD62L + CD4 + T cells from spleens of WT and Dohh -ΔT mice. Volcano plots depict all differentially regulated regions of open chromatin with immunologically relevant loci in orange. (G) YFP expression assessed in CD4 + T cells from 7-week-old WT and Dohh -ΔT-Great mice. Bar graphs depict % of cells YFP + in CD44 lo CD4 + T cells, representative contour plots are shown. (H and I) Naive WT and Odc −/− CD4 + T cells (H) and naive WT and Dohh −/− CD4 + T cells (I) electroporated with g Tbx21 or gCTRL with Cas9 and activated under T H 1 conditions. IFN-γ assessed by FC on day 4. All data are mean ± SEM (p ∗ < 0.05, p ∗∗ < 0.005, p ∗∗∗ < 0.0005, p ∗∗∗∗ < 0.00005). Representative of 1–3 (E), and of 2 (G–I) experiments. See also and .

Article Snippet: Alt-R S.p. Cas9 Nuclease V3 , IDT , Cat. 1081059.

Techniques: Cell Differentiation, RNA Sequencing, Staining, Expressing

Journal: Cell

Article Title: Polyamine metabolism is a central determinant of helper T cell lineage fidelity

doi: 10.1016/j.cell.2021.06.007

Figure Lengend Snippet: RNA-seq and ATAC-seq data from in vitro activated WT, Odc −/− , and Dohh −/− CD4 + T H cell subsets, related to Figure 6 Naive CD4 + T cells from WT, Odc -ΔT, and Dohh -ΔT mice polarized in indicated T H conditions for 96h were assessed by (A) RNA-seq or (B) ATAC-Seq. Volcano plots depict differentially regulated genes (A) or differentially regulated regions of open chromatin (B). (C) WT and Dohh −/− CD4 + T cells assayed for chromatin modifications by FC in indicated T H cell subset 96h post-activation/polarization. Analysis was performed on Ki-67 + cells and diploid cells with ‘single’ DNA content based on FxCycle (dapi) staining in the live cell gate. (D-F) Naive WT, Odc −/− and Dohh −/− CD4 + T cells electroporated with guide RNAs specific for Tbx21 (g Tbx21 ) or control guide (gCTRL) with Cas9 nuclease and activated under T H 17 conditions. After 4 days, levels of indicated cytokine or transcription factor assessed by FC. All data are mean ± SEM (p ∗ < 0.05, p ∗∗ < 0.005, p ∗∗∗ < 0.0005, p ∗∗∗∗ < 0.00005). (C) is representative of 1-3 experiments, (D-F) is representative of 2 experiments.

Article Snippet: Alt-R S.p. Cas9 Nuclease V3 , IDT , Cat. 1081059.

Techniques: RNA Sequencing, In Vitro, Activation Assay, Staining, Control

Journal: Cell

Article Title: Polyamine metabolism is a central determinant of helper T cell lineage fidelity

doi: 10.1016/j.cell.2021.06.007

Figure Lengend Snippet: HAT inhibition or deletion restores efficient T H differentiation in Odc −/− and Dohh −/− CD4 + T cells, related to and (A,B) Naive WT, Odc −/− and Dohh −/− CD4 + T cells deleted for Tbx21 using CRISPR Cas9 and polarized in T H 1 conditions. Levels of labeled protein was assessed by FC after 96h. (C) Naive CD4 + T cells from WT and Dohh -ΔT-Great mice deleted for Tbx21 as described in (A) and polarized for 96h in T H 1 conditions. YFP expression analyzed by FC, representative contour plots are shown. (D, E) Naive WT and Dohh −/− CD4 + T cells polarized in indicated condition for 72 hours. Cells were treated with 20 μM C646 for the final 48h of culture and assayed for (D) IFN-γ and T-bet or (E) H3k27 acetylation levels by FC. Analysis in (E) performed on Ki-67 + cells and diploid cells with ‘single’ DNA content based on FxCycle (dapi) staining in live cell gate. (F) Naive WT, Odc −/− and Dohh −/− CD4 + T cells electroporated with g P300 or a gCTRL with Cas9 nuclease and activated under T H 17 conditions. Protein expression was assessed after 96h. (G) Naive WT and Odc −/− CD4 + T cells were treated as in (F), after 96h H3k27 acetylation assessed by FC. (H) Naive WT and Odc −/− CD4 + T cells polarized for 72. Cells were treated with 20 μM CPTH2 for final 48h of culture and assayed for IFN-γ after 5h restimulation. (I) Naive WT and Odc −/− CD4 + T cells electroporated with g Kat2a or gCTRL with Cas9 nuclease and activated under T H 17 conditions. Indicated protein was assessed on day 4. (J) Naive WT and Odc −/− CD4 + T cells cultured for 72h under different polarizing conditions then exposed to 4 mM 13 C glutamine for 24h. Tracing of glutamine into stated metabolites was performed by mass spectrometry. (K) Naive WT and Dohh −/− CD4 + T cells activated with anti-CD3/CD28 for 72h then treated as in (J) for the flux of glutamine carbons into TCA cycle metabolites. All data are mean ± SEM (p ∗ < 0.05, p ∗∗ < 0.005, p ∗∗∗ < 0.0005, p ∗∗∗∗ < 0.00005). (A-C, F-I) Representative of two experiments, (D) Representative of 3 experiments, (E) is representative of one experiment.

Article Snippet: Alt-R S.p. Cas9 Nuclease V3 , IDT , Cat. 1081059.

Techniques: Inhibition, CRISPR, Labeling, Expressing, Staining, Cell Culture, Mass Spectrometry

Journal: Cell

Article Title: Polyamine metabolism is a central determinant of helper T cell lineage fidelity

doi: 10.1016/j.cell.2021.06.007

Figure Lengend Snippet: Histone acetyltransferases and a rewired TCA cycle govern the remodeled epigenome in Odc −/− and Dohh −/− CD4 + T cells (A) Naive CD4 + T cells from Odc -ΔT and Dohh -ΔT mice and their littermate controls were electroporated with g P300 or gCTRL with Cas9 and activated under T H 17 conditions for 96 h. Representative histograms of P300 levels are shown. (B and C) T-bet and IFN-γ expression (B) and H3k27 acetylation levels (C) in WT, Odc −/− , or Dohh −/− T cells as treated in (A). (D–F) Naive WT and Odc −/− CD4 + T cells electroporated with g Kat2a or gCTRL with Cas9 and activated under T H 17 conditions. After 96 h, proteins were assessed by immunoblot (D) or FC (E and F). (G) Naive WT and Odc −/− CD4 + T cells were polarized and after 72 h re-plated in 11 mM 13 C glucose for 24 h. Glucose tracing performed by MS. (H) MS analysis of 13 C glucose tracing in WT and Dohh −/− T H cells treated as in (G). (I) Naive WT and Odc −/− CD4 + T cells polarized in T H 17 conditions for 72 h. Cells were treated with 30 μM BMS303141 for the final 48 h of culture. (J) Naive WT or Odc −/− CD4 + T cells electroporated with g Acly or gCTRL with Cas9 and activated under T H 17 conditions. After 96 h, levels of the indicated protein were assessed by immunoblot. (K) Naive WT or Odc −/− CD4 + T cells treated as in (J). After 96 h, T-bet and IFN-γ were assessed by FC. All data are mean ± SEM (p ∗ < 0.05, p ∗∗ < 0.005, p ∗∗∗ < 0.0005, p ∗∗∗∗ < 0.00005). Representative of 2 (A–F, I, and J), or 1 experiment (G and H). See also Figure S7 .

Article Snippet: Alt-R S.p. Cas9 Nuclease V3 , IDT , Cat. 1081059.

Techniques: Expressing, Western Blot

Journal: Cell

Article Title: Polyamine metabolism is a central determinant of helper T cell lineage fidelity

doi: 10.1016/j.cell.2021.06.007

Figure Lengend Snippet:

Article Snippet: Alt-R S.p. Cas9 Nuclease V3 , IDT , Cat. 1081059.

Techniques: In Vitro, Activation Assay, In Vivo, Recombinant, Electroporation, Multiplex sample analysis, Control, CRISPR, Software

Journal: JCI Insight

Article Title: Vasopressin mediates fructose-induced metabolic syndrome by activating the V1b receptor

doi: 10.1172/jci.insight.140848

Figure Lengend Snippet: ( A ) 30-week cumulative total and fructose-derived caloric intake in WT (black), V1aR-KO (ochre), and V1bR-KO (green) mice on 10% fructose. ( B ) Serum copeptin levels in WT, V1aR-KO, and V1bR-KO mice receiving a 10% fructose solution for 30 weeks. ( C ) Weekly body weight gain in WT, V1aR-KO, and V1bR-KO mice receiving a 10% fructose solution for 30 weeks. ( D ) Representative H&E images from livers of mice ( n > 10 images per animal) of the same groups as in A at 30 weeks. Size bars: 50 μM. ( E ) Liver triglycerides (normalized to protein levels) at 30 weeks in WT, V1aR-KO, and V1bR-KO mice receiving a 10% fructose solution. ( F ) Serum ALT levels at 30 weeks in WT, V1aR-KO, and V1bR-KO mice receiving a 10% fructose solution. ( G ) Serum insulin levels at 30 weeks in WT, V1aR-KO, and V1bR-KO mice receiving a 10% fructose solution. ( H ) Serum leptin levels at 30 weeks in WT, V1aR-KO, and V1bR-KO mice receiving a 10% fructose solution. ( I ) Representative H&E images from epididymal adipose tissue of mice ( n > 10 images per animal) of the same groups as in A at 30 weeks. Size bars: 50 μM. ( J ) Total fat mass (g) at 30 weeks in WT, V1aR-KO, and V1bR-KO mice receiving a 10% fructose solution. ( K ) Fat mass to total body weight percentage at 30 weeks in WT, V1aR-KO, and V1bR-KO mice receiving a 10% fructose solution. The data in A–C , E–H , and J and K are presented as the mean ± SD and analyzed by 1-way ANOVA with Tukey’s post hoc analysis. * P < 0.05, ** P < 0.01. n = 6 mice per group. See also . V1aR, vasopressin 1a receptor; V1bR, vasopressin 1b receptor; PT, portal triad; CV, central vein; ALT, alanine aminotransferase.

Article Snippet: V1b deletion in HepG2 cells was performed employing lentiviral particles containing either shRNA sequences specific for human V1bR (Santa Cruz Biotechnologies, sc-40277-v) or scramble — noncodifying — shRNA control (sc-108080).

Techniques: Derivative Assay

Journal: JCI Insight

Article Title: Vasopressin mediates fructose-induced metabolic syndrome by activating the V1b receptor

doi: 10.1172/jci.insight.140848

Figure Lengend Snippet: ( A ) Transcriptional levels of the avpr1b in hypothalamus, pancreas, jejunum, kidney, liver, and spleen of WT mice on water Ctrl (clear purple bars) or receiving a 10% Frct solution for 30 weeks (solid purple bars). ( B ) Transcriptional levels of the avpr1a (red line) and the avpr1b (purple line) in liver of WT mice receiving a 10% Frct solution for 30 weeks. ( C and D ) Representative Western blot and densitometry ( n = 2 total blots) for the V1bR, fructokinase (KHK), and actin in human HepG2 cells Ctrl or exposed to AVP (250 nM), Frct (10 mM), or a combination of Frct plus AVP for 5 days. ( E ) KHK activity in HepG2 lysates from Ctrl, AVP, Frct, and Frct plus AVP cells. ( F ) Representative Western blot and densitometry ( n = 2 total blots) for V1bR and actin in HepG2 transduced with noncodifying shRNA ( scr ) or shRNA against avpr1b ( shAvpr1b ) at baseline or a Frct (10 mM) exposure. ( G ) Representative Western blot and densitometry ( n = 2 total blots) for KHK and actin in Ctrl, AVP, Frct, and Frct plus AVP HepG2 cells stably silenced for V1bR expression. ( H and I ) Representative Western blot ( n = 2 total blots) and densitometry for KHK, actin, and lipogenic enzymes FAS and ACC in the liver of WT and V1bR-KO mice on water Ctrl or receiving a 10% Frct solution for 30 weeks. The data in A and C–E are presented as the mean ± SD and analyzed by 1-way ANOVA with Tukey’s post hoc analysis. * P < 0.05, ** P < 0.01. For A and B and E , n = 6 mice per group. For C – E , n = 2 independent cultured plates. V1bR, vasopressin 1b receptor; avpr1b , vasopressin 1b receptor gene; avpr1a , vasopressin 1a receptor gene; KHK, ketohexokinase; Ctrl, control; AVP, vasopressin; Frct, fructose; scr , scramble; FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase.

Article Snippet: V1b deletion in HepG2 cells was performed employing lentiviral particles containing either shRNA sequences specific for human V1bR (Santa Cruz Biotechnologies, sc-40277-v) or scramble — noncodifying — shRNA control (sc-108080).

Techniques: Western Blot, Activity Assay, Transduction, shRNA, Stable Transfection, Expressing, Cell Culture, Control

Journal: JCI Insight

Article Title: Vasopressin mediates fructose-induced metabolic syndrome by activating the V1b receptor

doi: 10.1172/jci.insight.140848

Figure Lengend Snippet: (Left side, orange lines) Fructose stimulates both the expression of fructokinase (KHK) and the induction of the V1bR in the liver. Fructose metabolism in both liver and hypothalamus stimulates the production and secretion of AVP. The actions of AVP on hepatic V1bR potentiate the metabolic effects of fructose on the expression of KHK and lipogenic enzymes FAS and ACC. As a result, AVP and fructose promote fatty liver, adiposity, and body weight gain during the development and progression of metabolic syndrome. (Right side, blue lines) Hydration and other strategies directed to lower circulating AVP levels would decrease the hepatic expression of both V1bR and KHK in response to fructose. As a consequence, less fructose would be metabolized into fat, thus limiting the progression of metabolic syndrome. V1bR, vasopressin 1b receptor; AVP, vasopressin; KHK, ketohexokinase; FAS, fatty acid synthase; ACC, acetyl-CoA carboxylase.

Article Snippet: V1b deletion in HepG2 cells was performed employing lentiviral particles containing either shRNA sequences specific for human V1bR (Santa Cruz Biotechnologies, sc-40277-v) or scramble — noncodifying — shRNA control (sc-108080).

Techniques: Expressing

Journal: Cancer Science

Article Title: CD44 variant 6 is correlated with peritoneal dissemination and poor prognosis in patients with advanced epithelial ovarian cancer

doi: 10.1111/cas.12765

Figure Lengend Snippet: Association between CD44 variant 6 (CD44v6) expression pattern and clinicopathological characteristics in patients with stage III–IV ovarian cancer

Article Snippet: CD44v6 was detected with the mouse mAb CD44v6 (2F10; R&D Systems, Minneapolis, MN, USA).

Techniques: Variant Assay, Expressing

Journal: Cancer Science

Article Title: CD44 variant 6 is correlated with peritoneal dissemination and poor prognosis in patients with advanced epithelial ovarian cancer

doi: 10.1111/cas.12765

Figure Lengend Snippet: Disseminated ovarian tumors in the pelvic peritoneum contain highly enriched CD44 variant 6 (CD44v6)-positive cancer cells. (a) Immunohistochemical analysis with an anti-CD44v6 antibody in primary epithelial ovarian tumors. Scale bar = 500 μm. (b) Immunohistochemical staining with an anti-CD44v6 antibody in peritoneal disseminated tumors. Scale bar = 500 μm. (c) The percentage of CD44v6-positive cancer cells in primary and disseminated tumors. Peritoneal disseminated tumors contained significantly higher percentages of CD44v6-positive cells than primary tumors (Mann–Whitney U -test, ** P < 0.01).

Article Snippet: CD44v6 was detected with the mouse mAb CD44v6 (2F10; R&D Systems, Minneapolis, MN, USA).

Techniques: Variant Assay, Immunohistochemical staining, Staining, MANN-WHITNEY

Journal: Cancer Science

Article Title: CD44 variant 6 is correlated with peritoneal dissemination and poor prognosis in patients with advanced epithelial ovarian cancer

doi: 10.1111/cas.12765

Figure Lengend Snippet: CD44 variant 6 (CD44v6) expression predicts epithelial ovarian cancer survival. (a) Immunohistochemical analysis with an anti-CD44v6 antibody in primary epithelial ovarian tumors. The tumors that contained at least 10% CD44v6-positive cancer cells were categorized as the CD44v6-high group. Scale bar = 500 μm. (b) Immunohistochemical staining with an anti-CD44v6 antibody in primary tumors. The tumors that contained less than 10% CD44v6-positive cancer cells were categorized as the CD44v6-low group. Scale bar = 500 μm. (c) Kaplan–Meier analysis of overall survival in patients with stage III–IV ovarian cancer according to the expression of CD44v6. There were significant differences in overall survival between the CD44v6-high and CD44v6-low groups (** P = 0.0059). (d) Kaplan–Meier analysis of progression-free survival in patients with stage III–IV ovarian cancer according to the expression of CD44v6. Progression-free survival was not significantly different between the CD44v6-high and CD44v6-low groups ( P = 0.4290).

Article Snippet: CD44v6 was detected with the mouse mAb CD44v6 (2F10; R&D Systems, Minneapolis, MN, USA).

Techniques: Variant Assay, Expressing, Immunohistochemical staining, Staining

Journal: Cancer Science

Article Title: CD44 variant 6 is correlated with peritoneal dissemination and poor prognosis in patients with advanced epithelial ovarian cancer

doi: 10.1111/cas.12765

Figure Lengend Snippet: Hazard ratios (HRs) using univariate and multivariate Cox proportional hazard model

Article Snippet: CD44v6 was detected with the mouse mAb CD44v6 (2F10; R&D Systems, Minneapolis, MN, USA).

Techniques: Expressing

Journal: Cancer Science

Article Title: CD44 variant 6 is correlated with peritoneal dissemination and poor prognosis in patients with advanced epithelial ovarian cancer

doi: 10.1111/cas.12765

Figure Lengend Snippet: Subpopulation of CD44 variant 6 (CD44v6)-positive ovarian cancer cells possesses a high peritoneal metastatic ability. (a) Flow cytometric analysis of CD44v6 expression in ES-2 ovarian cancer cells. (b) Macroscopic appearance of disseminated tumors at 35 days after cell transplantation. CD44v6-positive cells generated more extensive disseminated tumors in the peritoneal cavity than CD44v6-negative cells. Scale bar = 2 cm. (c) Total weight of peritoneal disseminated tumors determined at 35 days after cell injection. Quantitative data are presented as mean ± SD for five mice. * P < 0.05. (d) Ascitic volume determined at 35 days after transplantation. Quantitative data are presented as mean ± SD for five mice. * P < 0.05. (e) Immunohistochemical analysis with antibody to CD44v6 in peritoneal disseminated tumors in a mouse model. Paraffin-embedded sections of disseminated tumors generated by CD44v6-positive cancer cells were subjected to immunohistochemical staining with an anti-CD44v6 antibody. Scale bar = 200 μm. (f) Western blot analysis of CD44v6 and epithelial–mesenchymal transition regulatory proteins, including E-cadherin, N-cadherin, fibronectin, and vimentin in FACS-sorted CD44v6-poisitive cells versus FACS-sorted CD44v6-negative cells.

Article Snippet: CD44v6 was detected with the mouse mAb CD44v6 (2F10; R&D Systems, Minneapolis, MN, USA).

Techniques: Variant Assay, Expressing, Transplantation Assay, Generated, Injection, Immunohistochemical staining, Staining, Western Blot

Journal: Cancer Science

Article Title: CD44 variant 6 is correlated with peritoneal dissemination and poor prognosis in patients with advanced epithelial ovarian cancer

doi: 10.1111/cas.12765

Figure Lengend Snippet: In vivo tumorigenicity of CD44 variant 6 (CD44v6)-positive and CD44v6-negative cells

Article Snippet: CD44v6 was detected with the mouse mAb CD44v6 (2F10; R&D Systems, Minneapolis, MN, USA).

Techniques: In Vivo, Variant Assay

Journal: Cancer Science

Article Title: CD44 variant 6 is correlated with peritoneal dissemination and poor prognosis in patients with advanced epithelial ovarian cancer

doi: 10.1111/cas.12765

Figure Lengend Snippet: CD44 variant 6 (CD44v6)-positive ovarian cancer cells are associated with chemoresistance. (a) Flow cytometric analysis of CD44v6 expression in ES-2 ovarian cancer cells treated with paclitaxel and untreated ES-2 cells. (b) Flow cytometric analysis of CD44v6 expression in ES-2 ovarian cancer cells treated with cisplatin and untreated ES-2 cells. (c) Chemosensitivity assay in FACS-sorted CD44v6-positive and FACS-sorted CD44v6-negative cells. Cells were subjected to MTS assay to evaluate viability in the presence of paclitaxel. * P < 0.05, ** P < 0.01. (d) Chemosensitivity assay. FACS-sorted CD44v6-positive and FACS-sorted CD44v6-negative cells were subjected to MTS assay to assess the viability in the presence of cisplatin. * P < 0.05, ** P < 0.01.

Article Snippet: CD44v6 was detected with the mouse mAb CD44v6 (2F10; R&D Systems, Minneapolis, MN, USA).

Techniques: Variant Assay, Expressing, MTS Assay